Review



vector pgl3 u6 sgrna egfp  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc vector pgl3 u6 sgrna egfp
    Vector Pgl3 U6 Sgrna Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+pgl3+u6+sgrna+egfp/pGL3-U6-sgRNA-EGFP+(Plasmid+%23107721)/bio_rxiv__64898__2026__01__16__698129-49-7-11
    Average 94 stars, based on 44 article reviews
    vector pgl3 u6 sgrna egfp - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Human PMS1-dependent non-canonical mismatch repair converges with MBD4 to repair 5-methylcytosine deamination
    Article Snippet: .. Single-guide RNA sequences were cloned into the vector pGL3-U6-sgRNA-EGFP ( ) (Addgene, 107721), including for 5mC target #1 in DNAJC16 (AGATACGAAAGAGATGGTGA), 5mC target #2 in LRP8 (TGAATCGAGGGGTGGGGAGA), C target #1 in STK38 (GAGTCGGAGGTTGGGGAAGG), C target #2 in HNRNPDL (TAAATCGTGAAATAAAAACA). .. HAP1 cells were plated in complete media 24h before transfection (1 million cells per well of 6-well plate), and media was replaced with fresh complete media supplemented with 1 μM Palbociclib (CST, 47284S) immediately before co-transfection with 1.4 μg CBE vector and 150 ng of each sgRNA vector per well with jetOPTIMUS (Polyplus, 101000051) at a 1:1 ratio.



    Similar Products

    pgl3 u6 sgrna egfp expression vectors  (Vazyme Biotech Co)
    96
    Vazyme Biotech Co pgl3 u6 sgrna egfp expression vectors
    Pgl3 U6 Sgrna Egfp Expression Vectors, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+pgl3+u6+sgrna+egfp/T4+DNA+Ligase/pmc09842798-27-19-26
    Average 96 stars, based on 1 article reviews
    pgl3 u6 sgrna egfp expression vectors - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    pgl3 u6 sgrna egfp expression vectors  (New England Biolabs)
    99
    New England Biolabs pgl3 u6 sgrna egfp expression vectors
    Pgl3 U6 Sgrna Egfp Expression Vectors, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+pgl3+u6+sgrna+egfp/T4+DNA+Ligase/pmc09842798-27-19-13
    Average 99 stars, based on 1 article reviews
    pgl3 u6 sgrna egfp expression vectors - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    vector pgl3 u6 sgrna egfp  (Addgene inc)
    94
    Addgene inc vector pgl3 u6 sgrna egfp
    Vector Pgl3 U6 Sgrna Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+pgl3+u6+sgrna+egfp/pGL3-U6-sgRNA-EGFP+(Plasmid+%23107721)/bio_rxiv__64898__2026__01__16__698129-49-7-11
    Average 94 stars, based on 1 article reviews
    vector pgl3 u6 sgrna egfp - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    pgl3 u6 sgrna egfp vector  (Addgene inc)
    94
    Addgene inc pgl3 u6 sgrna egfp vector
    Pgl3 U6 Sgrna Egfp Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+pgl3+u6+sgrna+egfp/pGL3-U6-sgRNA-EGFP+(Plasmid+%23107721)/pmc12173119-26-1-3
    Average 94 stars, based on 1 article reviews
    pgl3 u6 sgrna egfp vector - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    sgrna expression vector with gfp  (Addgene inc)
    94
    Addgene inc sgrna expression vector with gfp
    Sgrna Expression Vector With Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+pgl3+u6+sgrna+egfp/pGL3-U6-sgRNA-EGFP+(Plasmid+%23107721)/bio_rxiv__2024__06__30__601407-244-10-15
    Average 94 stars, based on 1 article reviews
    sgrna expression vector with gfp - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    pgl3 vector  (Addgene inc)
    94
    Addgene inc pgl3 vector
    Pgl3 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/vector+pgl3+u6+sgrna+egfp/pGL3-U6-sgRNA-EGFP+(Plasmid+%23107721)/pmc10076032-60-8-10
    Average 94 stars, based on 1 article reviews
    pgl3 vector - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results